2 umbilical cord blood as a source of components in transfusional therapy
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
Ngày tải lên :
19/06/2014, 22:20
... complex and the initiation of intracellular signaling events regulating oxidase assembly and activation has been described [31,32] The NADPH oxidase The phagocytic NADPH oxidase plays an essential ... Ishii K, Tokuda T, Matsushima T, Miya F, Shoji S, Ikeda S, Tamaoka A: Pravastatin at 10 mg/day does not decrease plasma levels of either amyloid-beta (Abeta) 40 or Abeta 42 in humans Neurosci ... microglial NADPH oxidase maybe largely responsible for the oxidative damage observed in the AD brain Astrocytes and the NADPH oxidase Astrocytes are the most abundant glial cell type in the brain and...
- 12
- 413
- 0
examining linguistic ambiguity as a source of constructing funniness in english verbal jockes = khảo sát hiện tượng mơ hồ ngôn ngữ với vai trò là một nguồn tạo nên tính hài hước của các câu chuyện tếu tiếng anh
Ngày tải lên :
02/03/2015, 14:32
... Hurford and Heasley (2001) assert that a word or sentence is considered ambiguous if and only if it has at least two paraphrases that are not themselves paraphrases of one another A good case in point ... (2) in chapter in fact is a typical example of this (2) A man eating a kebab goes up to a lady who has a yapping Chihuahua at her heels “Can I throw your dog a bit?” he asked politely “Certainly,” ... multiple meanings of either “an organization or a place that provides a financial service” or “the land sloping up along each side of a river or canal”, has created two separate interpretations of sentence...
- 85
- 621
- 1
A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2
Ngày tải lên :
16/07/2015, 07:45
... ABSTRACT Since the application of Communicative Language Teaching approach to EFL teaching, process writing and collaborative learning have been greatly emphasized as typical features of teaching ... literature II.2 An overview of assessment II.2.1 Definition of assessment There are many definitions of assessment which are listed as follows: According to Assessing Academic Programs in Higher ... other language skills in general and for writing skill in particular, classroom assessment can be understood as “an on-going process aiming at understanding and improving students’ learning” (Angelo...
- 65
- 893
- 7
A study on the mutual coupling effects between 2 rectangular patch antennas as a function of their separation and angles of elevation
Ngày tải lên :
26/09/2015, 10:43
... Simple arrays readily created Table 1.1: The Advantages and Disadvantages of Microstrip Antennas It is actually the last advantage in the list above that makes microstrip antennas so popular today ... there can be no radio wave propagation without antennas Antennas are so intricately intertwined with radio wave communications, and so important a part of it, that it has developed a life of its ... microstrip antennas by Bahl and Bhartia [4] The main assumption made in the transmission line model of the rectangular patch antenna is that it is resonating in the dominant mode in which two of the four...
- 104
- 329
- 0
Food as a Source of Dioxin Exposure in the Residents of Bien Hoa City, Vietnam
Ngày tải lên :
27/06/2016, 20:28
... 0.95 68 Channa Striata—snakehead Anabas Testudineus— climbing perch Clarias Fuscus— catfish Clarias Fuscus— catfish Ostechilus Hasselti— carp TABLE Comparison of Highest Dioxin TEQ Levels in ppt, ... clearly a present-day route of intake of dioxin from Agent Orange, as it might have been since the spraying began in 1962 In an area of Vietnam where recent TCDD exposure occurred and 95% of ... Channa Striata—snakehead Anabas Testudineus— climbing perch Clarias Fuscus— catfish Clarias Fuscus— catfish Ostechilus Hasselti— carp Discussion This is the most recent VietnamU.S collaborative...
- 8
- 513
- 1
Báo cáo y học: "Role of resistin as a marker of inflammation in systemic lupus erythematosus" ppsx
Ngày tải lên :
09/08/2014, 10:22
... regression analyses as independent variables and resistin as a dependent variable A forward stepwise method was used ESR and S-creatinine were defined as normal or pathological according to standard laboratory ... variables Analyses were also performed with z score total hip and radius as dependent variables using a cutoff value as -1 SD for normal or reduced bone mass Resistin was significantly associated ... in radius remained associated with resistin Oh and colleagues [35] have shown an inverse correlation of resistin to BMD in lumbar spine in an adult male Korean patient cohort also indicating...
- 9
- 460
- 1
báo cáo khoa học: "Elevated transaminases as a predictor of coma in a patient with anorexia nervosa: a case report and review of the literature" pot
Ngày tải lên :
11/08/2014, 02:21
... is available for review by the Editor -in- Chief of this journal Abbreviations ALB: albumin; AN: anorexia nervosa; AST: asparate aminotransferase; ALT: alanine aminotransferase; BCAA/AAA: branch-chain ... higher than that of the spleen in a patient with AN and elevated transaminases, whereas liver steatosis was diagnosed in ultrasound imaging, as was found in our patient In addition, these authors ... magnetic resonance imaging, and magnetic resonance angiography of the head showed no abnormality Aspartate aminotransferase was 3194 IU/L (reference range, to 38 IU/L); alanine aminotransferase,...
- 4
- 410
- 0
Báo cáo y học: "Bleeding from ruptured hepatic metastases as a cause of syncope in an octogenarian: a case report" pdf
Ngày tải lên :
11/08/2014, 12:20
... hemoperitoneum An acute intra-abdominal bleed from the liver metastatic disease was diagnosed Our patient had an esophageal gastro-duodenal endoscopy as he had been taking aspirin and had a past history of ... Dewar GA, Griffin SM, van Hasselt CA, et al.: Fatal haemoperitoneum due to liver metastases from nasopharyngeal cancer Aust N Z J of Surg 1991, 61(9):723-725 Yoshida H, Mamada Y, Taniai N, et al.: ... to be of metastatic disease within the liver (Figures 1, 2, No primary tumor was identified A diagnostic peritoneal tap was performed and frank blood was aspirated confirming that there was hemoperitoneum...
- 3
- 372
- 0
Báo cáo y học: " The utility of the Historical Clinical Risk -20 Scale as a predictor of outcomes in decisions to transfer patients from high to lower levels of security-A UK perspective" pptx
Ngày tải lên :
11/08/2014, 16:22
... records in the Offenders Index of the Home Office A reconviction was regarded as being “serious” in cases of murder, manslaughter, assault, rape, indecent assault towards adult male, adult female ... work, assisted in data analysis and assisted in drafting the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... in the North of England has adopted this instrument into routine clinical practice following a series of research based validation studies to examine its utility as part of its ongoing risk assessment...
- 8
- 388
- 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
Ngày tải lên :
12/08/2014, 17:22
... Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and gene ... biochemical analysis and statistical analysis, and was involved in preparation of the manuscript RP, TY and AH performed data acquisition and statistical analysis PJR participated in the design of ... Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 Reverse: TCCTGGAAGATGGTGATG expression of the Link N-treated discs was normalized to saline-treated discs Biochemical analysis...
- 9
- 402
- 0
Báo cáo y học: "Myocardial Doppler velocities as a marker of prognosis in the ICU" pot
Ngày tải lên :
13/08/2014, 08:20
... J, Papakostas L, Tahta SA, Hardy BG, Bollen BA, Duran CM, Levine RA: Mechanism of recurrent ischemic mitral regurgitation after annuloplasty: continued LV remodeling as a moving target Circulation ... differences in diastolic mitral annular motion as exemplified with E’ Whereas Doppler myocardial imaging allows more precise discrimination of the phase of diastolic dysfunction, Sturgess et al clearly ... Ylitalo A, Stolen KQ, Kalliokoski R, Nekolla SG, Bax KE et al: Assessment of right ventricular oxidative metabolism by PET in patients with idiopathic dilated cardiomyopathy undergoing cardiac...
- 2
- 262
- 0
Báo cáo y học: "Delirium as a predictor of sepsis in post-coronary artery bypass grafting patients: a retrospective cohort study" docx
Ngày tải lên :
13/08/2014, 21:21
... serving the province of Manitoba Data collection and variable selection The Maritime Heart Center Cardiac Surgery Registry and the Manitoba Cardiac Surgery Database are detailed clinical databases ... Cardiac Sciences at St Boniface Hospital in Winnipeg: Brenda Zahara, Rachel Gerstein, and Kim Wiebe are members of the Cardiovascular Health Research in Manitoba (CHaRM) Investigator Group and ... ventilation times, self-extubation, and re-intubation [10] Prolonged mechanical ventilation, as well as an increased number of airway procedures, are known to increase the risk of Martin et al Critical...
- 6
- 305
- 0
Báo cáo y học: "Diarrhea as a cause of mortality in a mouse model of infectious colitis" ppt
Ngày tải lên :
14/08/2014, 20:22
... performed on transformed data A p-value < 0.05 was regarded as statistically significant Abbreviations A/ E, attaching and effacing; AP, activator protein; AQP, aquaporin; CA, carbonic anhydrase; CFTR, ... anhydrases CA I and CA IV and aquaporins Aqp4 and Aqp8 [78-80] These results indicate that infectious diarrhea and noninfectious inflammationassociated diarrhea may have common mechanisms of pathogenesis ... reagent according to the recommendations of the manufacturer (Invitrogen, Carlsbad, CA, USA) RNA was treated with DNase I and purified using an RNeasy Clean-up kit as recommended by the manufacturer...
- 19
- 300
- 0
Students perceptions of using portfolios as a means of evaluation in an english foreign language translation course
Ngày tải lên :
30/11/2015, 09:14
... STATEMENT OF AUTHORSHIP Title: Students’ Perceptions of Using Portfolios as a Means of Evaluation in an English Foreign Language Translation Course, a Case Study at the Faculty of Foreign Languages, ... ABSTRACT The purpose of this study is to investigate students’ perceptions of benefits of using portfolios as a means of evaluating their learning process in a translation course and find ... Languages, Hanoi Pedagogical University N02” (Graduation paper submitted in partial fulfillment of The Degree of Bachelor of Arts in English) I certify that all the materials in this study has...
- 7
- 361
- 1
Báo cáo khoa học: A novel, promoter-based, target-specific assay identifies 2-deoxy-D-glucose as an inhibitor of globotriaosylceramide biosynthesis docx
Ngày tải lên :
30/03/2014, 01:20
... construct was verified by sequencing Establishment of stable transfectants and the luciferase assay An aliquot of 0.4 lg of each plasmid was transfected into · 105 HeLa cells with lipofectamine2000 (Invitrogen, ... region of the Gb3S gene was amplified by PCR using HeLa cell genomic DNA as a template The following PCR primers were used: 5¢-TGAGTCGACTCAG CTCTTGGAGGGGCAACA-3¢ and 5¢-GCGCGCACAAA TGTCGCCTCCAGAACA-3¢ ... reports have indicated that abnormal expression and ⁄ or accumulation can lead to several disease states For example, patients with Fabry disease, an X-linked lysosomal storage disease caused by...
- 12
- 303
- 0
Báo cáo hóa học: "Safety evaluation of allogeneic umbilical cord blood mononuclear cell therapy for degenerative conditions" pot
Ngày tải lên :
18/06/2014, 16:20
... SPSS 13.0 statistical package was applied for statistical analysis Results Administration of cord blood mononuclear cells via intrathecal and intravenous routes was well tolerated No allergic or ... suspension was given through an intravenous catheter in 15-20 minutes Statistics Adverse events were analyzed for all 114 cases, and are presented as percentage values For analysis of laboratory parameters, ... clinical treatment YZ analyzed and interpreted data and drafted the manuscript FW carried out the clinical treatment and collected data WM analyzed data and helped to draft the manuscript BM participated...
- 6
- 420
- 0
Báo cáo sinh học: " Human umbilical cord blood-derived mononuclear cell transplantation: case series of 30 subjects with Hereditary Ataxia'''' docx
Ngày tải lên :
18/06/2014, 19:20
... duration at the time of treatment was 26 years Patients treated came from Australia, Britain, Canada, China, Chile, Italy, South Africa and U.S .A There were no significant demographic or baseline ... cases) and cases of FRDA The mean age was 43.14 ± 12.77 (range 19 to 71 years) The male-female gender ratio was 18:12 On average, patients had ataxias for 10.74 ± 5.89 years The longest disease ... Cord blood derived cells are being investigated in a myriad of preclinical disease models [18,19,24,25] The safety of CBMC transplantation has been investigated in several human clinical trials...
- 5
- 324
- 0